Review



custom synthesized dna fragments  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98

    Structured Review

    Thermo Fisher custom synthesized dna fragments
    Custom Synthesized Dna Fragments, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/custom+synthesized+dna+fragment/Deoxyribonucleic+acid/pm38182620-350-12-18
    Average 98 stars, based on 1 article reviews
    custom synthesized dna fragments - by Bioz Stars, 2026-09
    98/100 stars

    Images

    Related Articles

    Cell Culture:

    Article Title: Pigs Lacking the Scavenger Receptor Cysteine-Rich Domain 5 of CD163 Are Resistant to Porcine Reproductive and Respiratory Syndrome Virus 1 Infection
    Article Snippet: Viral RNA levels 388 were assessed by RT-qPCR using the GoTaq 1-Step RT-qPCR system (Promega) analyzed on a 389 LightCycler II 480 (Roche). .. Viral RNA extracted from PAM cell culture supernatant with 390 known multiplicity of infection (MOI) and a custom synthesized DNA fragment (Invitrogen) 391 with known concentration 392 (GAGAGCGGCCGCTAATACGACTCACTATAGTCAGCTGTGTCAGCTGCTGGGAAAAATGATGAAATC393 CCAGCGCCAGCAACCCAGGGGAGGACAGGCCAACAAAAGGAAAAAGCCTGAGAAGCCTCATTTTCCC394 TTGGCTGCTGAAGATGACGTTCGGCACCATCTCACCGCAACTGAGCGTTCCCTCTGTCTGCAATCGAT395 CCAGACAGCCTTCAATCAGGGTGCAGGAACTGCGTCGCTTTCACCCAGTGGGAAGGTCAGTTTTCAG396 GTAGAGTTCATGCTGCCCCTGCAGGGAGA) were used as standards. ..

    Infection:

    Article Title: Pigs Lacking the Scavenger Receptor Cysteine-Rich Domain 5 of CD163 Are Resistant to Porcine Reproductive and Respiratory Syndrome Virus 1 Infection
    Article Snippet: Viral RNA levels 388 were assessed by RT-qPCR using the GoTaq 1-Step RT-qPCR system (Promega) analyzed on a 389 LightCycler II 480 (Roche). .. Viral RNA extracted from PAM cell culture supernatant with 390 known multiplicity of infection (MOI) and a custom synthesized DNA fragment (Invitrogen) 391 with known concentration 392 (GAGAGCGGCCGCTAATACGACTCACTATAGTCAGCTGTGTCAGCTGCTGGGAAAAATGATGAAATC393 CCAGCGCCAGCAACCCAGGGGAGGACAGGCCAACAAAAGGAAAAAGCCTGAGAAGCCTCATTTTCCC394 TTGGCTGCTGAAGATGACGTTCGGCACCATCTCACCGCAACTGAGCGTTCCCTCTGTCTGCAATCGAT395 CCAGACAGCCTTCAATCAGGGTGCAGGAACTGCGTCGCTTTCACCCAGTGGGAAGGTCAGTTTTCAG396 GTAGAGTTCATGCTGCCCCTGCAGGGAGA) were used as standards. ..

    Synthesized:

    Article Title: Pigs Lacking the Scavenger Receptor Cysteine-Rich Domain 5 of CD163 Are Resistant to Porcine Reproductive and Respiratory Syndrome Virus 1 Infection
    Article Snippet: Viral RNA levels 388 were assessed by RT-qPCR using the GoTaq 1-Step RT-qPCR system (Promega) analyzed on a 389 LightCycler II 480 (Roche). .. Viral RNA extracted from PAM cell culture supernatant with 390 known multiplicity of infection (MOI) and a custom synthesized DNA fragment (Invitrogen) 391 with known concentration 392 (GAGAGCGGCCGCTAATACGACTCACTATAGTCAGCTGTGTCAGCTGCTGGGAAAAATGATGAAATC393 CCAGCGCCAGCAACCCAGGGGAGGACAGGCCAACAAAAGGAAAAAGCCTGAGAAGCCTCATTTTCCC394 TTGGCTGCTGAAGATGACGTTCGGCACCATCTCACCGCAACTGAGCGTTCCCTCTGTCTGCAATCGAT395 CCAGACAGCCTTCAATCAGGGTGCAGGAACTGCGTCGCTTTCACCCAGTGGGAAGGTCAGTTTTCAG396 GTAGAGTTCATGCTGCCCCTGCAGGGAGA) were used as standards. ..

    Concentration Assay:

    Article Title: Pigs Lacking the Scavenger Receptor Cysteine-Rich Domain 5 of CD163 Are Resistant to Porcine Reproductive and Respiratory Syndrome Virus 1 Infection
    Article Snippet: Viral RNA levels 388 were assessed by RT-qPCR using the GoTaq 1-Step RT-qPCR system (Promega) analyzed on a 389 LightCycler II 480 (Roche). .. Viral RNA extracted from PAM cell culture supernatant with 390 known multiplicity of infection (MOI) and a custom synthesized DNA fragment (Invitrogen) 391 with known concentration 392 (GAGAGCGGCCGCTAATACGACTCACTATAGTCAGCTGTGTCAGCTGCTGGGAAAAATGATGAAATC393 CCAGCGCCAGCAACCCAGGGGAGGACAGGCCAACAAAAGGAAAAAGCCTGAGAAGCCTCATTTTCCC394 TTGGCTGCTGAAGATGACGTTCGGCACCATCTCACCGCAACTGAGCGTTCCCTCTGTCTGCAATCGAT395 CCAGACAGCCTTCAATCAGGGTGCAGGAACTGCGTCGCTTTCACCCAGTGGGAAGGTCAGTTTTCAG396 GTAGAGTTCATGCTGCCCCTGCAGGGAGA) were used as standards. ..



    Similar Products

    90
    Twist Bioscience custom-synthesized, mutation-containing dna fragments
    A . The m1, m2, and m3 mutants compromises SH2 single-cell replication to varying extents. The m1-G, m1-R, m2-G, m2-R, m3-G, m3-R constructs are derivatives of LM5-G and LM5-R, respectively, with corresponding m1, m2, and m3 mutations. The pairs of constructs were delivered into N. benthamiana epidermal cells via agro-infiltration. The cells were observed with a confocal microscope and photographed at 4 days post agro-infiltration. B. Semi-quantitative PCR assessing relative accumulation levels of viral genomic <t>DNA</t> in cells receiving constructs shown above the lanes. Note the PCR primers do not distinguish between the GFP- and mCherry-coding constructs. Also note that the non-replicating C1fs1 mutant (containing a <t>frameshift</t> <t>mutation</t> in Rep coding sequence) was included as a negative control. C . N. benthamiana plants showing symptoms of different SH2 mutants 6 and 9 weeks post inoculation (agro-infiltration) (6 and 9 wpi). D . Assessing the relative levels of viral genomic DNA using semi-quantitative PCR in plants treated with m1, m2, and m3 mutants. At 1 wpi, the agro-infiltrated leaves (IL) of two representative plants were analyzed, whereas at 6 and 9 wpi, the systemic leaves (SL) were exmined. The numbers of PCR cycles were also shown. The rDNA control were always amplified for 15 cycles.
    Custom Synthesized, Mutation Containing Dna Fragments, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/custom+synthesized+dna+fragment/synthetic+dna+fragments/bio_rxiv__2025__05__27__656274-289-8-10
    Average 90 stars, based on 1 article reviews
    custom-synthesized, mutation-containing dna fragments - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Eurofins custom synthesized dna fragments
    A . The m1, m2, and m3 mutants compromises SH2 single-cell replication to varying extents. The m1-G, m1-R, m2-G, m2-R, m3-G, m3-R constructs are derivatives of LM5-G and LM5-R, respectively, with corresponding m1, m2, and m3 mutations. The pairs of constructs were delivered into N. benthamiana epidermal cells via agro-infiltration. The cells were observed with a confocal microscope and photographed at 4 days post agro-infiltration. B. Semi-quantitative PCR assessing relative accumulation levels of viral genomic <t>DNA</t> in cells receiving constructs shown above the lanes. Note the PCR primers do not distinguish between the GFP- and mCherry-coding constructs. Also note that the non-replicating C1fs1 mutant (containing a <t>frameshift</t> <t>mutation</t> in Rep coding sequence) was included as a negative control. C . N. benthamiana plants showing symptoms of different SH2 mutants 6 and 9 weeks post inoculation (agro-infiltration) (6 and 9 wpi). D . Assessing the relative levels of viral genomic DNA using semi-quantitative PCR in plants treated with m1, m2, and m3 mutants. At 1 wpi, the agro-infiltrated leaves (IL) of two representative plants were analyzed, whereas at 6 and 9 wpi, the systemic leaves (SL) were exmined. The numbers of PCR cycles were also shown. The rDNA control were always amplified for 15 cycles.
    Custom Synthesized Dna Fragments, supplied by Eurofins, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/custom+synthesized+dna+fragment/dna+fragment/pmc12077210-250-8-38
    Average 90 stars, based on 1 article reviews
    custom synthesized dna fragments - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Twist Bioscience custom synthesized dna fragment
    A . The m1, m2, and m3 mutants compromises SH2 single-cell replication to varying extents. The m1-G, m1-R, m2-G, m2-R, m3-G, m3-R constructs are derivatives of LM5-G and LM5-R, respectively, with corresponding m1, m2, and m3 mutations. The pairs of constructs were delivered into N. benthamiana epidermal cells via agro-infiltration. The cells were observed with a confocal microscope and photographed at 4 days post agro-infiltration. B. Semi-quantitative PCR assessing relative accumulation levels of viral genomic <t>DNA</t> in cells receiving constructs shown above the lanes. Note the PCR primers do not distinguish between the GFP- and mCherry-coding constructs. Also note that the non-replicating C1fs1 mutant (containing a <t>frameshift</t> <t>mutation</t> in Rep coding sequence) was included as a negative control. C . N. benthamiana plants showing symptoms of different SH2 mutants 6 and 9 weeks post inoculation (agro-infiltration) (6 and 9 wpi). D . Assessing the relative levels of viral genomic DNA using semi-quantitative PCR in plants treated with m1, m2, and m3 mutants. At 1 wpi, the agro-infiltrated leaves (IL) of two representative plants were analyzed, whereas at 6 and 9 wpi, the systemic leaves (SL) were exmined. The numbers of PCR cycles were also shown. The rDNA control were always amplified for 15 cycles.
    Custom Synthesized Dna Fragment, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/custom+synthesized+dna+fragment/dna+fragment+encoding+the+following+elements/pm39413138-374-11-15
    Average 90 stars, based on 1 article reviews
    custom synthesized dna fragment - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    GenScript corporation custom synthesized dna fragments
    A . The m1, m2, and m3 mutants compromises SH2 single-cell replication to varying extents. The m1-G, m1-R, m2-G, m2-R, m3-G, m3-R constructs are derivatives of LM5-G and LM5-R, respectively, with corresponding m1, m2, and m3 mutations. The pairs of constructs were delivered into N. benthamiana epidermal cells via agro-infiltration. The cells were observed with a confocal microscope and photographed at 4 days post agro-infiltration. B. Semi-quantitative PCR assessing relative accumulation levels of viral genomic <t>DNA</t> in cells receiving constructs shown above the lanes. Note the PCR primers do not distinguish between the GFP- and mCherry-coding constructs. Also note that the non-replicating C1fs1 mutant (containing a <t>frameshift</t> <t>mutation</t> in Rep coding sequence) was included as a negative control. C . N. benthamiana plants showing symptoms of different SH2 mutants 6 and 9 weeks post inoculation (agro-infiltration) (6 and 9 wpi). D . Assessing the relative levels of viral genomic DNA using semi-quantitative PCR in plants treated with m1, m2, and m3 mutants. At 1 wpi, the agro-infiltrated leaves (IL) of two representative plants were analyzed, whereas at 6 and 9 wpi, the systemic leaves (SL) were exmined. The numbers of PCR cycles were also shown. The rDNA control were always amplified for 15 cycles.
    Custom Synthesized Dna Fragments, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/custom+synthesized+dna+fragment/dna+fragments/pm39048693-299-9-11
    Average 90 stars, based on 1 article reviews
    custom synthesized dna fragments - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    GenScript corporation plasmid representing the sars-cov-2/human/dnk/dk-ahh1/2020 isolate and custom synthesized dna fragments
    A . The m1, m2, and m3 mutants compromises SH2 single-cell replication to varying extents. The m1-G, m1-R, m2-G, m2-R, m3-G, m3-R constructs are derivatives of LM5-G and LM5-R, respectively, with corresponding m1, m2, and m3 mutations. The pairs of constructs were delivered into N. benthamiana epidermal cells via agro-infiltration. The cells were observed with a confocal microscope and photographed at 4 days post agro-infiltration. B. Semi-quantitative PCR assessing relative accumulation levels of viral genomic <t>DNA</t> in cells receiving constructs shown above the lanes. Note the PCR primers do not distinguish between the GFP- and mCherry-coding constructs. Also note that the non-replicating C1fs1 mutant (containing a <t>frameshift</t> <t>mutation</t> in Rep coding sequence) was included as a negative control. C . N. benthamiana plants showing symptoms of different SH2 mutants 6 and 9 weeks post inoculation (agro-infiltration) (6 and 9 wpi). D . Assessing the relative levels of viral genomic DNA using semi-quantitative PCR in plants treated with m1, m2, and m3 mutants. At 1 wpi, the agro-infiltrated leaves (IL) of two representative plants were analyzed, whereas at 6 and 9 wpi, the systemic leaves (SL) were exmined. The numbers of PCR cycles were also shown. The rDNA control were always amplified for 15 cycles.
    Plasmid Representing The Sars Cov 2/Human/Dnk/Dk Ahh1/2020 Isolate And Custom Synthesized Dna Fragments, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/custom+synthesized+dna+fragment/cpass+sars+cov+2+neutralization+antibody+detection+kit/pmc11269720-290-1-11
    Average 90 stars, based on 1 article reviews
    plasmid representing the sars-cov-2/human/dnk/dk-ahh1/2020 isolate and custom synthesized dna fragments - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    98
    Thermo Fisher custom synthesized dna fragments
    A . The m1, m2, and m3 mutants compromises SH2 single-cell replication to varying extents. The m1-G, m1-R, m2-G, m2-R, m3-G, m3-R constructs are derivatives of LM5-G and LM5-R, respectively, with corresponding m1, m2, and m3 mutations. The pairs of constructs were delivered into N. benthamiana epidermal cells via agro-infiltration. The cells were observed with a confocal microscope and photographed at 4 days post agro-infiltration. B. Semi-quantitative PCR assessing relative accumulation levels of viral genomic <t>DNA</t> in cells receiving constructs shown above the lanes. Note the PCR primers do not distinguish between the GFP- and mCherry-coding constructs. Also note that the non-replicating C1fs1 mutant (containing a <t>frameshift</t> <t>mutation</t> in Rep coding sequence) was included as a negative control. C . N. benthamiana plants showing symptoms of different SH2 mutants 6 and 9 weeks post inoculation (agro-infiltration) (6 and 9 wpi). D . Assessing the relative levels of viral genomic DNA using semi-quantitative PCR in plants treated with m1, m2, and m3 mutants. At 1 wpi, the agro-infiltrated leaves (IL) of two representative plants were analyzed, whereas at 6 and 9 wpi, the systemic leaves (SL) were exmined. The numbers of PCR cycles were also shown. The rDNA control were always amplified for 15 cycles.
    Custom Synthesized Dna Fragments, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/custom+synthesized+dna+fragment/Deoxyribonucleic+acid/pm38182620-350-12-18
    Average 98 stars, based on 1 article reviews
    custom synthesized dna fragments - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    86
    Danaher Inc custom synthesized dna fragments
    A . The m1, m2, and m3 mutants compromises SH2 single-cell replication to varying extents. The m1-G, m1-R, m2-G, m2-R, m3-G, m3-R constructs are derivatives of LM5-G and LM5-R, respectively, with corresponding m1, m2, and m3 mutations. The pairs of constructs were delivered into N. benthamiana epidermal cells via agro-infiltration. The cells were observed with a confocal microscope and photographed at 4 days post agro-infiltration. B. Semi-quantitative PCR assessing relative accumulation levels of viral genomic <t>DNA</t> in cells receiving constructs shown above the lanes. Note the PCR primers do not distinguish between the GFP- and mCherry-coding constructs. Also note that the non-replicating C1fs1 mutant (containing a <t>frameshift</t> <t>mutation</t> in Rep coding sequence) was included as a negative control. C . N. benthamiana plants showing symptoms of different SH2 mutants 6 and 9 weeks post inoculation (agro-infiltration) (6 and 9 wpi). D . Assessing the relative levels of viral genomic DNA using semi-quantitative PCR in plants treated with m1, m2, and m3 mutants. At 1 wpi, the agro-infiltrated leaves (IL) of two representative plants were analyzed, whereas at 6 and 9 wpi, the systemic leaves (SL) were exmined. The numbers of PCR cycles were also shown. The rDNA control were always amplified for 15 cycles.
    Custom Synthesized Dna Fragments, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/custom+synthesized+dna+fragment/us11034980-563-9-13
    Average 86 stars, based on 1 article reviews
    custom synthesized dna fragments - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    90
    BioCat GmbH custom synthesized dna fragment
    A . The m1, m2, and m3 mutants compromises SH2 single-cell replication to varying extents. The m1-G, m1-R, m2-G, m2-R, m3-G, m3-R constructs are derivatives of LM5-G and LM5-R, respectively, with corresponding m1, m2, and m3 mutations. The pairs of constructs were delivered into N. benthamiana epidermal cells via agro-infiltration. The cells were observed with a confocal microscope and photographed at 4 days post agro-infiltration. B. Semi-quantitative PCR assessing relative accumulation levels of viral genomic <t>DNA</t> in cells receiving constructs shown above the lanes. Note the PCR primers do not distinguish between the GFP- and mCherry-coding constructs. Also note that the non-replicating C1fs1 mutant (containing a <t>frameshift</t> <t>mutation</t> in Rep coding sequence) was included as a negative control. C . N. benthamiana plants showing symptoms of different SH2 mutants 6 and 9 weeks post inoculation (agro-infiltration) (6 and 9 wpi). D . Assessing the relative levels of viral genomic DNA using semi-quantitative PCR in plants treated with m1, m2, and m3 mutants. At 1 wpi, the agro-infiltrated leaves (IL) of two representative plants were analyzed, whereas at 6 and 9 wpi, the systemic leaves (SL) were exmined. The numbers of PCR cycles were also shown. The rDNA control were always amplified for 15 cycles.
    Custom Synthesized Dna Fragment, supplied by BioCat GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/custom+synthesized+dna+fragment/dna+fragments/pmc06509287-383-38-42
    Average 90 stars, based on 1 article reviews
    custom synthesized dna fragment - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    99
    Thermo Fisher custom synthesized dna fragment
    A . The m1, m2, and m3 mutants compromises SH2 single-cell replication to varying extents. The m1-G, m1-R, m2-G, m2-R, m3-G, m3-R constructs are derivatives of LM5-G and LM5-R, respectively, with corresponding m1, m2, and m3 mutations. The pairs of constructs were delivered into N. benthamiana epidermal cells via agro-infiltration. The cells were observed with a confocal microscope and photographed at 4 days post agro-infiltration. B. Semi-quantitative PCR assessing relative accumulation levels of viral genomic <t>DNA</t> in cells receiving constructs shown above the lanes. Note the PCR primers do not distinguish between the GFP- and mCherry-coding constructs. Also note that the non-replicating C1fs1 mutant (containing a <t>frameshift</t> <t>mutation</t> in Rep coding sequence) was included as a negative control. C . N. benthamiana plants showing symptoms of different SH2 mutants 6 and 9 weeks post inoculation (agro-infiltration) (6 and 9 wpi). D . Assessing the relative levels of viral genomic DNA using semi-quantitative PCR in plants treated with m1, m2, and m3 mutants. At 1 wpi, the agro-infiltrated leaves (IL) of two representative plants were analyzed, whereas at 6 and 9 wpi, the systemic leaves (SL) were exmined. The numbers of PCR cycles were also shown. The rDNA control were always amplified for 15 cycles.
    Custom Synthesized Dna Fragment, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/custom+synthesized+dna+fragment/DNA/10__1128_slash_jvi__00415___18-196-17-21
    Average 99 stars, based on 1 article reviews
    custom synthesized dna fragment - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    Image Search Results


    A . The m1, m2, and m3 mutants compromises SH2 single-cell replication to varying extents. The m1-G, m1-R, m2-G, m2-R, m3-G, m3-R constructs are derivatives of LM5-G and LM5-R, respectively, with corresponding m1, m2, and m3 mutations. The pairs of constructs were delivered into N. benthamiana epidermal cells via agro-infiltration. The cells were observed with a confocal microscope and photographed at 4 days post agro-infiltration. B. Semi-quantitative PCR assessing relative accumulation levels of viral genomic DNA in cells receiving constructs shown above the lanes. Note the PCR primers do not distinguish between the GFP- and mCherry-coding constructs. Also note that the non-replicating C1fs1 mutant (containing a frameshift mutation in Rep coding sequence) was included as a negative control. C . N. benthamiana plants showing symptoms of different SH2 mutants 6 and 9 weeks post inoculation (agro-infiltration) (6 and 9 wpi). D . Assessing the relative levels of viral genomic DNA using semi-quantitative PCR in plants treated with m1, m2, and m3 mutants. At 1 wpi, the agro-infiltrated leaves (IL) of two representative plants were analyzed, whereas at 6 and 9 wpi, the systemic leaves (SL) were exmined. The numbers of PCR cycles were also shown. The rDNA control were always amplified for 15 cycles.

    Journal: bioRxiv

    Article Title: Rescue of tomato yellow leaf curl virus mutants with heterologous iterons through in planta evolution

    doi: 10.1101/2025.05.27.656274

    Figure Lengend Snippet: A . The m1, m2, and m3 mutants compromises SH2 single-cell replication to varying extents. The m1-G, m1-R, m2-G, m2-R, m3-G, m3-R constructs are derivatives of LM5-G and LM5-R, respectively, with corresponding m1, m2, and m3 mutations. The pairs of constructs were delivered into N. benthamiana epidermal cells via agro-infiltration. The cells were observed with a confocal microscope and photographed at 4 days post agro-infiltration. B. Semi-quantitative PCR assessing relative accumulation levels of viral genomic DNA in cells receiving constructs shown above the lanes. Note the PCR primers do not distinguish between the GFP- and mCherry-coding constructs. Also note that the non-replicating C1fs1 mutant (containing a frameshift mutation in Rep coding sequence) was included as a negative control. C . N. benthamiana plants showing symptoms of different SH2 mutants 6 and 9 weeks post inoculation (agro-infiltration) (6 and 9 wpi). D . Assessing the relative levels of viral genomic DNA using semi-quantitative PCR in plants treated with m1, m2, and m3 mutants. At 1 wpi, the agro-infiltrated leaves (IL) of two representative plants were analyzed, whereas at 6 and 9 wpi, the systemic leaves (SL) were exmined. The numbers of PCR cycles were also shown. The rDNA control were always amplified for 15 cycles.

    Article Snippet: A few mutants were generated with custom-synthesized, mutation-containing DNA fragments (TWIST Biosciences).

    Techniques: Construct, Microscopy, Real-time Polymerase Chain Reaction, Mutagenesis, Sequencing, Negative Control, Control, Amplification

    De novo mutations identified in m1 and m2 descendants enhance m2 symptoms. A . Iteron portion sequences of new m2-based mutants incorporating the de novo mutations; and sequences of their descendants at 6 wpi. B . Relative accumulation levels of SH2, m1, m2, m2a, and m2b in IL at 1 wpi. C . Symptoms of infected plants at 6 wpi. D . Accumulation levels of viral DNA in SL at 6 wpi as measured with 35 cycles of PCR. Note the absence of viral DNA in three of the m2-infected plants, and the extremely low accumulation in the fourth.

    Journal: bioRxiv

    Article Title: Rescue of tomato yellow leaf curl virus mutants with heterologous iterons through in planta evolution

    doi: 10.1101/2025.05.27.656274

    Figure Lengend Snippet: De novo mutations identified in m1 and m2 descendants enhance m2 symptoms. A . Iteron portion sequences of new m2-based mutants incorporating the de novo mutations; and sequences of their descendants at 6 wpi. B . Relative accumulation levels of SH2, m1, m2, m2a, and m2b in IL at 1 wpi. C . Symptoms of infected plants at 6 wpi. D . Accumulation levels of viral DNA in SL at 6 wpi as measured with 35 cycles of PCR. Note the absence of viral DNA in three of the m2-infected plants, and the extremely low accumulation in the fourth.

    Article Snippet: A few mutants were generated with custom-synthesized, mutation-containing DNA fragments (TWIST Biosciences).

    Techniques: Infection

    The TC-to-GT mutations of m2b are sufficient to rescue viral replication even if one or both of the flanking iteron motifs (of Y35 origin) are eliminated. A . Iteron portion sequences of the mutants, their absence/presence in 6 wpi SL, stability of the mutations, and SL symptoms. B . Semi-quantitative PCR assessing the viral DNA levels in IL for a selected set of mutants (m2g, m2b-g). C . Symptoms of representative mutants at 6 wpi. D . Detection of viral DNA in SL with PCR (35 cycles) at 6 wpi.

    Journal: bioRxiv

    Article Title: Rescue of tomato yellow leaf curl virus mutants with heterologous iterons through in planta evolution

    doi: 10.1101/2025.05.27.656274

    Figure Lengend Snippet: The TC-to-GT mutations of m2b are sufficient to rescue viral replication even if one or both of the flanking iteron motifs (of Y35 origin) are eliminated. A . Iteron portion sequences of the mutants, their absence/presence in 6 wpi SL, stability of the mutations, and SL symptoms. B . Semi-quantitative PCR assessing the viral DNA levels in IL for a selected set of mutants (m2g, m2b-g). C . Symptoms of representative mutants at 6 wpi. D . Detection of viral DNA in SL with PCR (35 cycles) at 6 wpi.

    Article Snippet: A few mutants were generated with custom-synthesized, mutation-containing DNA fragments (TWIST Biosciences).

    Techniques: Real-time Polymerase Chain Reaction